karmabowers246822 karmabowers246822
  • 04-05-2020
  • History
contestada

I need help pleaseeeeeeeee

I need help pleaseeeeeeeee class=

Respuesta :

zoeknick zoeknick
  • 04-05-2020

Answer:

B or D

Explanation:

Hope this helps just a little bit.

Answer Link
IsaacDoubleA IsaacDoubleA
  • 04-05-2020
crhhrbrbfbfgbbggbcncjvjejjrbrbfbfjcigjjnvnfng the first letter :)
Answer Link

Otras preguntas

one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the reproductive system of a male mammal provides
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
who fought against each other in the crusades?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
How did the mountains in Greece contribute to the rise of city-states?