Seudónimo Seudónimo
  • 04-07-2020
  • Mathematics
contestada

Please answer this correctly

Please answer this correctly class=

Respuesta :

fluffyowo
fluffyowo fluffyowo
  • 04-07-2020

Answer:

50%

Step-by-step explanation:

not even = 2 nums

pnoteven = 2 ÷ 4 × 100

Answer Link
Wolfyy
Wolfyy Wolfyy
  • 04-07-2020

We are given 4 cards.

2 numbers are even and 2 numbers are odd.

So, 2/4 or 0.5 are odd

0.5 * 100% = 50%

Therefore, the answer is 50%.

Best of Luck!

Answer Link

Otras preguntas

Regents what was a goal of progressive era reforms such as recall, referendum, and the direct primary?
a club has 5 members. from these members, the positions of president and vice-president have to be filled. how many different ways can these 2 positions be fill
The montreal school of scholars have drawn together a still-growing framework about the ways in which communication constitutes organization.
The group that receives the treatment or test stimulus or factor under study is called the
Which constitutional amendment allowed voting for citizens who were eighteen or older?
The Hellenistic age was characterized by all of the following EXCEPT
To what does the poet compare the lass? A. nomads B. musicians C. birds D. sailors
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
I need help on exterior angles!
What did Chinese traders exchange with Islamic merchants?