sabrinaunderhillx sabrinaunderhillx

02-02-2021
Mathematics

contestada

Sana bought a dress for $32.99 and two purses. The total cost for the three items was $57.97. What was the cost for one purse?

Respuesta :

02-02-2021

Answer:

$12.49

Step-by-step explanation:

cost of two purses = $57.97 - cost of dress = $57.97 - $32.99 = $24.98

cost of one purse = $24.98 ÷ 2 = $12.49

Answer Link

Otras preguntas

One of the benefits that the gi bill of rights offered to returning veterans was

Find the parabola with equation y = ax2 + bx whose tangent line at (3, 12) has equation y = 10x − 18. y = incorrect: your answer is incorrect.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What advice would you give someone whose life dream is to become a judge?

what is the relationship between hitech and hipaa

A guitarist uses ________ to recall how to play the notes of a specific song. episodic memory procedural memory semantic memory a flashbulb memory

Associating objects that elicit an undesirable response with unpleasant or negative stimuli describes the key principle of ____.

Which are barriers to seeking mental health treatment? Check all that apply. feeling embarrassed having health insurance dealing with peer pressure having limit

I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..

how many moles of NaCl are equivalent to 15.6g NaCl