BayonettaIsMyBaeTwo BayonettaIsMyBaeTwo

04-02-2021
Business

contestada

Is it better to create a product that benefits society or create a product that consumers want?

Respuesta :

Аноним Аноним

04-02-2021

Answer:

Benifits society

Explanation:

Answer Link

Otras preguntas

Your bedroom measures 3 1/2 yards by 4 1/4 yards if you wanted to carpet the bedroom, and you were able to buy a carpet measuring 5 yards by 5 yards, how many s

e Arlington Motor Pool Internal Service Fund had the following transactions and events during January 2018. Using the "Additional Information" provided below. P

Using the verb in parentheses, write the correct command for the subject given. Ud. (cantar) (1 point) 2. Ud. (escribir) (1 point) 3. Ud. (mirar) (1 poi

A transit train from Boston to New York and a passenger train from New York to Boston departed at the same time, at 3:00 PM. The distance between New York stati

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

You ....brush your teeth after every meal, if possible.shouldn't mustn't mustshould

Can someone please help me understand these 3 probability math problems.

a rectangle has an area of 135 square meters and has a width that is 6 meters shorter than its length what is the perimeter of the rectangle

In Mandatory Military Service in America, with which of the following would the Vietnam veteran most likely agree? a) "A large number of Americans believe that

Voters in Lincoln School District approved the construction of a new high school and approved an $8 million bond issue with a stated rate of interest of 6% to f