nvrIoasales nvrIoasales

02-11-2016
Biology

contestada

Where would a tundra biome be located?
a. south america
b. africa
c. australia
d. canada?

Respuesta :

LittleRedMe LittleRedMe

02-11-2016

Canada as it is far from the equator

Answer Link

Otras preguntas

A rectangular garden hasblengtg and width as given by thr expression below length 4-7(3x+4y) eifth 3x(-2y) write a simplifird expression for the perimeter of th

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re

Brainliest to most helpful! Answer asap! The point (−3, 1) is on the terminal side of angle θ, in standard position. What are the values of sine, cosine, and ta

Why do you think James Meredith continued his march, even after he was shot?

zimmerman note definition

Collusive strategies are the third type of cooperative strategies. In many economies, explicit collusive strategies are legal unless otherwise sanctioned by gov

Which of the following best describes the rights given to the citizens of Jamestown by the Virginia Charter of 1606?

Make w the subject of Y-aw=2w-1

who invented the theory of relativity