nanawusu0202 nanawusu0202
  • 03-04-2021
  • Business
contestada

a. Was Apple wrong for not complying with the F
BI’s request?


​

Respuesta :

shazm036319 shazm036319
  • 03-04-2021

Answer:

No

Explanation:

"It would be wrong to intentionally weaken our products with a government-ordered backdoor."

one reason being that if passcodes could be input electronically, iPhones would become easier to unlock via "brute force."

The government would be able to destroy the amazing privacy policy apple has

Answer Link

Otras preguntas

Create and write a 3 page script of a fairy tale mash up with at least 3 different fairy tale characters
Read the description of the centrioles. What is their function?
BRAINLIEST:) What would be a good rebuttal for this counterclaim. Don't write nonsense pls Counterclaim: Teenagers should not be forced to volunteer in order to
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
So i have an assignment to do, and i need people to help me. Can someone choose one drink, one main food, and one side from the chick-fil-A menu, and say the to
please help due in one hour
The distance y (in miles) that Train A travels in x hours is represented by the equation y=68x . The graph shows the distance that Train B travels. (0, 0) and (
The area for the trapezoid is__in2.
Explain the positive and negative aspects of entrepreneurship. Draw evidence to support your claim from two other sources.
Given the equation x + 2y = 0, which equation will form a system of linear equations without a solution? Please help