youl0iroc2ktayladee youl0iroc2ktayladee
  • 03-12-2016
  • Mathematics
contestada

A machine make 24 items in 8 minutes how many can it make in 14

Respuesta :

baabaagreysheep
baabaagreysheep baabaagreysheep
  • 03-12-2016
To get from 8 minutes to 14 minutes, you divide by 4 and multiply by 7. Therefore, if you divide 24 by 4 (6) and multiply by 7 (42), then you get the answer of 42 items in 14 minutes. Hope this helps!
Answer Link

Otras preguntas

Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
How do you put allele in a sentence
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
A vehicle is only 15% efficient. What happened to the other 85%?
Graph the first six terms of a sequence where a1 = -10 and d = 3.
p(x) x^3+x^2-x-1 Find all zeros of p (x)