tahseenyasmeen379
tahseenyasmeen379 tahseenyasmeen379
  • 01-08-2021
  • Mathematics
contestada

.....................​

 class=

Respuesta :

Аноним Аноним
  • 01-08-2021

Answer:

2nd option is the correct one

log|x|-f(x)+k

Answer Link

Otras preguntas

A spring on a horizontal surface can be stretched and held 0.5 m from its equilibrium position with a force of 60 N. a. How much work is done in stretching the
what was the point of view of harry truman doctrine speech
Charles owns a hardware store. He put hammers and nails on sale last weekend. His first customer bought 3 hammers and 16 nails for $22.96. His last customer bou
A gas at 110.0 kPa and 30.0˚C fills a flexible container with an initial volume of 2.00 L. If the temperature is raised to 80.0˚C and the pressure increased to
3. Which of these is two thousandeighty six?A 2,860® 2,806© 2,068D 2,086​
You expect KT industries​ (KTI) will have earnings per share of $ 6 this year and expect that they will pay out $ 2.25 of these earnings to shareholders in the
Which shapes have 2 obtuse angles? Choose all that are correct?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Micah is sitting in a seat on top of a 200-foot high Ferris wheel looking down at his brother Koda. The angle of depression to Koda is 80o. How far is Koda from
Estimate a 15% tip on a dinner bill of 31.51 by first rounding the bill amount to the nearest ten dollars.