oliverroldan81
oliverroldan81 oliverroldan81
  • 01-03-2022
  • History
contestada

Hi I need help in History
Answer the yellow box below
plsss
I will give brainlist
No links

Hi I need help in HistoryAnswer the yellow box below plsssI will give brainlist No links class=

Respuesta :

helloiamsam helloiamsam
  • 02-03-2022

Answer:

Sacagawea helped Lewis and Clark’s expedition succeed.

Explanation:

Lewis and Clark asked Charbonneau and Sacagawea to help them because Sacagawea could speak the Shoshone language and it would be a tremendous help when they met the Shoshone farther west and even though Sacagawea was pregnant, the two agreed.

Hope this helped!

Answer Link

Otras preguntas

What type of stock receives an equal part of the profits on each share to be distributed after all other obligations of a company have been satisfied? A.
In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.
can anyone help me to solve these 2 questions please I need very clear steps !!!!
Abraham lincoln's and andrew johnson's reconstruction plans shared an emphasis on
Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.
A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle
what is the most important factor that holds a gene pool of a species together and prevents speciation?
The non-proliferation treaty attempts to prevent the spread of __________ weapons.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
what's the ph of citric acid