Fabariche
Fabariche Fabariche
  • 05-07-2022
  • History
contestada

state four weaknesses of the Guggisberg constitution in social studies​

Respuesta :

angycat10 angycat10
  • 05-07-2022

Answer:

1. The official majority in the Legislative council remained as it was under the Clifford constitution before it.

2. Africans were excluded from the Executive Council.
3. The Northern Territories and British Mandated Togoland were largely excluded from the provisions of the constitution.
4. The governor still had veto power over bills in the Legislative Council.

I hope this helps :)

Explanation:

Answer Link

Otras preguntas

What is the value of x?
. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm
The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac
Which quotation from the text best supports the inference that the people of the sac nation do not typically challenge authority? "if he declared war he must le
Can someone Help me with that please
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the elapsed time
Improved functional health can be a positive influence on which health risk/
Observing people and asking them questions are the two principal ways to obtain
who invented the theory of relativity