jeovannivasquez jeovannivasquez
  • 03-03-2017
  • Mathematics
contestada

18 % of 90 is what number

Respuesta :

Hahssanthedude
Hahssanthedude Hahssanthedude
  • 03-03-2017
18 percent of 90 is 16.2
Answer Link
Dave1357
Dave1357 Dave1357
  • 03-03-2017

18 % of 90 is 16.2

Hope this helps! :D

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
why did russia have revolution in 1917?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Give a recursive algorithm for finding the sum of the first n odd positive integers.
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
A light bulb converts electrical energy into electromagnetic energy is true or false?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left