jasinblake729 jasinblake729
  • 01-01-2018
  • Chemistry
contestada

What is the name of the compound having the formula (nh4)2[cu(cn)4]?

Respuesta :

Аноним Аноним
  • 09-01-2018
Co2 is what its called

Answer Link

Otras preguntas

(-5x^2)^3 plzzzz help
The dodecahedron can be constructed from the repetitive folding of _____. A. equilateral triangles B. squares C. triangles D. regular pentagons
A major difference between major depressive disorder and bipolar disorder is that only in bipolar disorder do people have _____. a. hallucinations or delusions
What is the lowest level of measurement that a median can be computed?
what is the value of the expression i × i²× i³× i⁴
Would someone please help me with my french? Thank you! Fill in the blank after reading the options and looking at the pictures. I will type out the options her
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
What is the lowest level of measurement that a median can be computed?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What are the different ways of interpreting the title of the short story was it a dream