ashhleyjohnson ashhleyjohnson
  • 03-02-2018
  • Mathematics
contestada

Please help with question!

Please help with question class=

Respuesta :

TheAakash
TheAakash TheAakash
  • 03-02-2018
The volume of a cylinder (vc) is given by:
[tex]v_c = \pi r^2h[/tex]

In this case, you are given the diameter, and the radius is diameter/2. So, it will be:
[tex]r = \frac{17.5}{2} = 8.75 [/tex]

Now, you have everything given to plug into the equation. Let's do that:
[tex]v_c = (3.14)(8.75)^2(24.5)[/tex]

Simplify and solve to get:
[tex]v_c = 5889.95 [/tex]

So, your answer is 5889.95 ft³.
Answer Link

Otras preguntas

When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?
Can I get some help with these questions thank you
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
Which tortoises, mainland or island, need to eat more food per gram of their body mass?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
does mercury have a magnetic field
A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.
(60) Points HeLp asap 5 questions
Why is the answer for #6 A?
Need help on this geometry please someone ?