Seudónimo Seudónimo

04-01-2016
English

contestada

Round each number to the nearest ten 343.42 – 39.87

Respuesta :

Аноним Аноним

05-01-2016

The answer would be 300.60 rounded to nearest 10

343.42
_ 39.87
______
303.55

Answer Link

cristal240p cristal240p

05-01-2016

1. 340
2. 40

hope that helped :)

Answer Link

Otras preguntas

What is 1/3 divided by 9

help please i’ll give brainliest

Gender in the Population of Part-time College Students According to a 2010 report from the American Council on Education, females make up 57% of the U.S. colleg

In describing jimmy wells as the truest, most loyal fellow, what tone is conveyed? A: Silly B: Admiring C: Cheerful D: Confused

the kingdom, one of six kingdoms of life, is known for it's ability to survive in extreme enviroments

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

List the following four activities in the order they go in the physical activity pyramid from top to bottom. Soccer practice; Homework; walking 30 minutes to sc

In a labor market characterized by bilateral monopoly, the wage rate will Multiple Choice be logically indeterminate. be established at the level desired by the

Solve for ddd: d+\left(-5.004\right)=2.826d+(−5.004)=2.826d, plus, left parenthesis, minus, 5, point, 004, right parenthesis, equals, 2, point, 826 d =d=

36x+32=32x-36 whats the value of x